Marker Name: Vf_Mt1g072140 |
Map Name | Fine map of zt2 genomic region Gutierrez et al. 2020 |
Linkage Group & Location cM | Linkage Group: MAYA x DISCO Location cM: 0 |
Marker Information | Medicago locus NCBI: MTR_1g072140 Gene description: Transducin/WD40 repeatprotein Forward primer: TGCGTCAAATTCTCCAACGA Reverse primer: AGAGTAGCAACAAGTATAAATTTCCC Product length: 554 Tm= 54 C |
Reference | Gutierrez et al. 2020 link |
Marker Name: Vf_Mt1g072140 |
Map Name | Fine map of zt2 genomic region Gutierrez et al. 2020 |
Linkage Group & Location cM | Linkage Group: Vf6 x zt2 Location cM: 28.3 |
Marker Information | Medicago locus NCBI: MTR_1g072140 Gene description: Transducin/WD40 repeatprotein Forward primer: TGCGTCAAATTCTCCAACGA Reverse primer: AGAGTAGCAACAAGTATAAATTTCCC Product length: 554 Tm= 54 C |
Reference | Gutierrez et al. 2020 link |