Morad_Mokhtar

in vitro Validated EST-SSR Primers


Primer Id:  Vf_EST-SSR_GO_14822
Repeat Type and Sequence Tri;      (ATT)5 Image
Primer Start and End in EST 2............386
Forward Primer TCCATCTCCTCCTCCTCTGT      Tm= 59      Size= 20     GC%= 55
Reverse Primer CTTGCCGGTTGAAACATGCA      Tm= 60      Size= 20     GC%= 50
Product Size 385
Gene Ontology Categories and Link Biological Process: electron transport chain      GO:0022900
Protein Link (UniProtKB) A0A1S2YKW5
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_15185
Repeat Type and Sequence Tri;      (ACA)5 Image
Primer Start and End in EST 205............689
Forward Primer GCGCCATTGTAATTCCCTGC      Tm= 60      Size= 20     GC%= 55
Reverse Primer GGAGACATGTACGGAGCTGG      Tm= 60      Size= 20     GC%= 60
Product Size 485
Gene Ontology Categories and Link Biological Process: regulation of transcription DNA-templated      GO:0006355
Protein Link (UniProtKB) G7IKH9
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_17243
Repeat Type and Sequence Di;      (TC)6 Image
Primer Start and End in EST 58............223
Forward Primer ACACTCTCAATTCTCTCGGAGC      Tm= 60      Size= 22     GC%= 50
Reverse Primer ATGAACGGCAGGCATTTTCG      Tm= 60      Size= 20     GC%= 50
Product Size 166
Gene Ontology Categories and Link Biological Process: ATP metabolic process      GO:0046034
Protein Link (UniProtKB) A0A072URM9
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_14687
Repeat Type and Sequence Di;      (CT)15 Image
Primer Start and End in EST 76............575
Forward Primer GCCTAGAAGCCACGCAATTC      Tm= 60      Size= 20     GC%= 55
Reverse Primer GAGCCTCGATGGTACCACAG      Tm= 60      Size= 20     GC%= 60
Product Size 500
Gene Ontology Categories and Link Biological Process: oxidation-reduction process      GO:0055114
Protein Link (UniProtKB) Q2HTY1
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_14705
Repeat Type and Sequence Tri;      (CTT)5 Image
Primer Start and End in EST 70............476
Forward Primer CATGTCACTGCCCATCACCT      Tm= 60      Size= 20     GC%= 55
Reverse Primer CCGATGCCATTTTGCTGTTGA      Tm= 60      Size= 21     GC%= 48
Product Size 407
Gene Ontology Categories and Link Biological Process: protein phosphorylation      GO:0006468
Protein Link (UniProtKB) A0A072V7B9
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_14745
Repeat Type and Sequence Hexa;      (CTAACC)4 Image
Primer Start and End in EST 0............395
Forward Primer GGATTGCCTTCTCAACCAACC      Tm= 59      Size= 21     GC%= 52
Reverse Primer ACCGTTCCTGCCTTCTCTTG      Tm= 60      Size= 20     GC%= 55
Product Size 396
Gene Ontology Categories and Link Biological Process: DNA replication      GO:0006260
Protein Link (UniProtKB) G7J8I4
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_14849
Repeat Type and Sequence Tri;      (GAA)5 Image
Primer Start and End in EST 97............556
Forward Primer CGTTTCGGCATTGTGTTTGG      Tm= 59      Size= 20     GC%= 50
Reverse Primer AAACACCCTCCACCTCCAAC      Tm= 60      Size= 20     GC%= 55
Product Size 460
Gene Ontology Categories and Link Biological Process: protein phosphorylation      GO:0006468
Protein Link (UniProtKB) A0A072TR20
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_14880
Repeat Type and Sequence Tri;      (ATC)6 Image
Primer Start and End in EST 204............594
Forward Primer TTCTTCAAGACAACCATGAACATT      Tm= 57      Size= 24     GC%= 33
Reverse Primer TGTTGGACTTTGTGAGCTTGG      Tm= 59      Size= 21     GC%= 48
Product Size 391
Gene Ontology Categories and Link Molecular Function: antiporter activity      GO:0015297
Protein Link (UniProtKB) A0A1S5QNQ2
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_18191
Repeat Type and Sequence Hexa;      (TGAGAG)3 Image
Primer Start and End in EST 290............764
Forward Primer GGATGTGTGGTTATGGCTTCC      Tm= 59      Size= 21     GC%= 52
Reverse Primer ACTGGTGCAATCCTTCTGCA      Tm= 60      Size= 20     GC%= 50
Product Size 475
Gene Ontology Categories and Link Biological Process: defense response      GO:0006952
Protein Link (UniProtKB) V7CDQ7
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Vf_EST-SSR_GO_18276
Repeat Type and Sequence Di;      (TC)6 Image
Primer Start and End in EST 71............395
Forward Primer GTCACTGCCTCACTCCACAA      Tm= 60      Size= 20     GC%= 55
Reverse Primer CCAATCGCACCCTTACCTGT      Tm= 60      Size= 20     GC%= 55
Product Size 325
Gene Ontology Categories and Link Biological Process: ATP metabolic process      GO:0046034
Protein Link (UniProtKB) A0A1S3E3A7
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.