Morad_Mokhtar

In silico PCR Tool

Instruction: in silico PCR tool allows the search and localization of your primers in Vicia faba sequences that integrated in our database (All NCBI EST sequences, Reference transcriptom sequence) or your private sequence. We integrated the in silico PCR tool in our database to search and localization of your primers in Vicia faba sequences or any other sequences.

Using your private sequence

Enter your sequence below in FASTA format such as:

>Seq1

CGTGTCACAGTCGTCTCCAAGCACAACGATGACGAGCAGTACGTGTGGGAGTACCATCAGACCAGACACTG GTGAACCTATTGGCCG

>Seq2

GCCATTTCGTGTCACAGTCGTCTCCAAGCACAACGATTTTAAAGGCTGAAGACCAGACACTGGTGAACCTATTGGCCGGAAGCATTTT









Using Vicia Faba sequences that integrated in our database








Download your previous results





Note: Your previous In Silico PCR results will be kept in web server for one month only.

Note: in silico PCR scripts downloaded from the website (https://github.com/egonozer/in_silico_pcr) developed by (Egon A. Ozer).