Morad_Mokhtar

in vitro Validated Mitochondrial SSR Primers (mtSSRs)


Primer Id:  Mito-SSR2
Repeat Type and Sequence Penta;      (AAGAG)3 Image
Primer Start and End in Genome 12750............13021
Forward Primer GCCAATCGGGAGGAAAGGAA      Tm= 60      Size= 20     GC%= 55
Reverse Primer ACCTCGTCAGGATAGAGGCA      Tm= 60      Size= 20     GC%= 55
Product Size 271
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 12750 ............ 13021

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR9
Repeat Type and Sequence Penta;      (CTCTA)3 Image
Primer Start and End in Genome 154025............154216
Forward Primer AAGTAGCTTGTCTGCCGGAC      Tm= 60      Size= 20     GC%= 55
Reverse Primer CGGTGATCGGCCTGTCTATC      Tm= 60      Size= 20     GC%= 60
Product Size 191
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 154025 ............ 154216

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR24
Repeat Type and Sequence Compound;      (T)10(AG)6 Image
Primer Start and End in Genome 350269............350542
Forward Primer CCCCGTAGCTTGCTTCCATT      Tm= 60      Size= 20     GC%= 55
Reverse Primer CGCGAAGTTGGTGAAACCTG      Tm= 60      Size= 20     GC%= 55
Product Size 273
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 350269 ............ 350542

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR36
Repeat Type and Sequence Hexa;      (TAAGTA)3 Image
Primer Start and End in Genome 2926............3099
Forward Primer TGGGTATAGGAACCACCCCC      Tm= 60      Size= 20     GC%= 60
Reverse Primer TGGATCAACCAACCGGCTAT      Tm= 59      Size= 20     GC%= 50
Product Size 173
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 2926 ............ 3099

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR1
Repeat Type and Sequence Hexa;      (TAAGTA)3 Image
Primer Start and End in Genome 2926............3099
Forward Primer TGGGTATAGGAACCACCCCC      Tm= 60      Size= 20     GC%= 60
Reverse Primer TGGATCAACCAACCGGCTAT      Tm= 59      Size= 20     GC%= 50
Product Size 173
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 2926 ............ 3099

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR4
Repeat Type and Sequence Mono;      (A)11 Image
Primer Start and End in Genome 30390............30698
Forward Primer GGGTACGCTCACTTCTGCAT      Tm= 60      Size= 20     GC%= 55
Reverse Primer TCCCGCGGGACATTTCTAAC      Tm= 60      Size= 20     GC%= 55
Product Size 308
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 30390 ............ 30698

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR17
Repeat Type and Sequence Di;      (AG)6 Image
Primer Start and End in Genome 231913............232193
Forward Primer CGATGTGGTGTCCAGTCACA      Tm= 60      Size= 20     GC%= 55
Reverse Primer CAGGGGTGATCATTGCCCAT      Tm= 60      Size= 20     GC%= 55
Product Size 280
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 231913 ............ 232193

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR30
Repeat Type and Sequence Mono;      (T)11 Image
Primer Start and End in Genome 421589............421875
Forward Primer ATTGTTTATGCGGCAGTGCG      Tm= 60      Size= 20     GC%= 50
Reverse Primer CACAAAAGGGGCGAACCAAG      Tm= 60      Size= 20     GC%= 55
Product Size 286
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 421589 ............ 421875

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Primer Id:  Mito-SSR39
Repeat Type and Sequence Mono;      (A)11 Image
Primer Start and End in Genome 503824............504173
Forward Primer TTCAGGTCGATCAGAAGGCG      Tm= 60      Size= 20     GC%= 55
Reverse Primer AAGTGCCCGATTATAGCCCG      Tm= 60      Size= 20     GC%= 55
Product Size 349
JBrowse View      JBrowse
Corresponding Sequence

KC189947.1: 503824 ............ 504173

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.