Morad_Mokhtar

in vitro Validated EST Primers


Sequence Id:  v.faba_CSFL_reftransV2_0020115
Primer Start and End in EST 118............420 Image
Forward Primer TGCAAGTTAGAAGGCCTGCA      Tm= 60      Size= 20     GC%= 50
Reverse Primer GAAGCAACCCCAAAACGGTG      Tm= 60      Size= 20     GC%= 55
Product Size 303
Gene Ontology Categories and Link Biological Process: response to stress      GO:0006950
Protein Link (UniProtKB) G7idR7
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0032354
Primer Start and End in EST 2608............3187 Image
Forward Primer CCTCCGAGCCAGTTCCAAAT      Tm= 60      Size= 20     GC%= 55
Reverse Primer GGCGAGTTTCAGTCTGGACA      Tm= 60      Size= 20     GC%= 55
Product Size 580
Gene Ontology Categories and Link Biological Process: signal transduction      GO:0007165
Protein Link (UniProtKB) Q9SW94
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0008914
Primer Start and End in EST 40............233 Image
Forward Primer TGAGCGTCTCGTTCTTTGCT      Tm= 60      Size= 20     GC%= 50
Reverse Primer AAGGGGAGCCAAAATGCACT      Tm= 60      Size= 20     GC%= 50
Product Size 194
Gene Ontology Categories and Link Biological Process: response to stress      GO:0006950
Protein Link (UniProtKB) A0A1S2Y8R8
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0004263
Primer Start and End in EST 1342............2082 Image
Forward Primer CAAAGCCAAACTTCGCGTCA      Tm= 60      Size= 20     GC%= 50
Reverse Primer CCGGCGCATCAAATCTTGAG      Tm= 60      Size= 20     GC%= 55
Product Size 741
Gene Ontology Categories and Link Biological Process: signal transduction      GO:0007165
Protein Link (UniProtKB) G7IM52
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0035866
Primer Start and End in EST 1548............1954 Image
Forward Primer GATGAACGTCGCTGTCATGC      Tm= 60      Size= 20     GC%= 55
Reverse Primer CGATAGCGGGCTTGAGCTTA      Tm= 60      Size= 20     GC%= 55
Product Size 407
Gene Ontology Categories and Link Biological Process: signal transduction      GO:0007165
Protein Link (UniProtKB) G7KNZ7
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0008622
Primer Start and End in EST 40............146 Image
Forward Primer CGTGTCACAGTCGTCTCCAA      Tm= 60      Size= 20     GC%= 55
Reverse Primer CGGCCAATAGGTTCACCAGT      Tm= 60      Size= 20     GC%= 55
Product Size 107
Gene Ontology Categories and Link Biological Process: response to stress      GO:0006950
Protein Link (UniProtKB) L7VXD3
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0030175
Primer Start and End in EST 120............550 Image
Forward Primer TCGATCATCATGCGACGTGT      Tm= 60      Size= 20     GC%= 50
Reverse Primer TTAACAGCACCGACCAGTCC      Tm= 60      Size= 20     GC%= 55
Product Size 431
Gene Ontology Categories and Link Biological Process: signal transduction      GO:0007165
Protein Link (UniProtKB) A0A072UN45
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0031923
Primer Start and End in EST 1967............2096 Image
Forward Primer GATGGCACCCTTGTAGCAGT      Tm= 60      Size= 20     GC%= 55
Reverse Primer AAAAACCACGAAGCCGAAGC      Tm= 60      Size= 20     GC%= 50
Product Size 130
Gene Ontology Categories and Link Biological Process: signal transduction      GO:0007165
Protein Link (UniProtKB) E2IXG1
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0009330
Primer Start and End in EST 182............319 Image
Forward Primer TGCAGCATCAACTTCCCCAA      Tm= 60      Size= 20     GC%= 50
Reverse Primer AATGTGGAGGTGGTGAAGGC      Tm= 60      Size= 20     GC%= 55
Product Size 138
Gene Ontology Categories and Link Biological Process: response to stress      GO:0006950
Protein Link (UniProtKB) G7L957
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.

Sequence Id:  v.faba_CSFL_reftransV2_0012744
Primer Start and End in EST 179............343 Image
Forward Primer AGAGGAGTAGCAACCTCCGT      Tm= 60      Size= 20     GC%= 55
Reverse Primer AACCGTTGCTCGTAGGTCAG      Tm= 60      Size= 20     GC%= 55
Product Size 165
Gene Ontology Categories and Link Biological Process: response to stress      GO:0006950
Protein Link (UniProtKB) A0A1S2XX97
JBrowse View      JBrowse
Corresponding Sequence

Download

Image Legend Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 represent faba bean cultivars. Misr1, Misr3, Wadi1, Giza 843, Nobaria 1, Nobaria 2, Nobaria 3, Sakhi 1, Sakhi 3, FAB 6719, FAB 5911, FAB 495, FAB 391, FAB 6901, FAB 6004, FAB 7391, FAB 6391, FAB 222, FAB 6899 and FAB 297, respectively.