Morad_Mokhtar

Enzyme Id: K00033         Number of primers: 2



Enzyme Id:  K00033   &  Pathway Id:  ko01200

Sequence Id v.faba_CSFL_reftransV2_0035274
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_8g099185        UniProtKB Protein Id: A0A072TUR1
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CGACTATTGCAGCGTCGTTG      Tm= 60      GC%= 55
Reverse Primer CACCACTCTGACGAGCAAGT      Tm= 60      GC%= 55
Product Size 612
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K00033   &  Pathway Id:  ko01200

Sequence Id v.faba_CSFL_reftransV2_0027795
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_7g017900        UniProtKB Protein Id: A0A072TX81
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AGTCCGGCAAGACCTATCCT      Tm= 60      GC%= 55
Reverse Primer CACCGCAAAACACGTGCTAA      Tm= 60      GC%= 50
Product Size 712
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download