|
Sequence Id | v.faba_CSFL_reftransV2_0035274 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g099185 UniProtKB Protein Id: A0A072TUR1 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | CGACTATTGCAGCGTCGTTG Tm= 60 GC%= 55 |
Reverse Primer | CACCACTCTGACGAGCAAGT Tm= 60 GC%= 55 |
Product Size | 612 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |
|
Sequence Id | v.faba_CSFL_reftransV2_0027795 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_7g017900 UniProtKB Protein Id: A0A072TX81 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | AGTCCGGCAAGACCTATCCT Tm= 60 GC%= 55 |
Reverse Primer | CACCGCAAAACACGTGCTAA Tm= 60 GC%= 50 |
Product Size | 712 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |