|
| Sequence Id | v.faba_CSFL_reftransV2_0024184 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101506489 UniProtKB Protein Id: A0A1S2YZA7 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GCTTCCTCCATAGCCGAGTC Tm= 60 GC%= 60 |
| Reverse Primer | TTCGGTTATCGTCGCTACCG Tm= 60 GC%= 55 |
| Product Size | 183 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0032721 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101499933 UniProtKB Protein Id: A0A1S2YT47 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCGGAATATCGGAGCTGCAC Tm= 60 GC%= 55 |
| Reverse Primer | CGACCAAACAAATGGCTGCA Tm= 60 GC%= 50 |
| Product Size | 481 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0005054 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g053160 UniProtKB Protein Id: A0A072VJM3 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CACCGACACGTAGATACCGG Tm= 60 GC%= 60 |
| Reverse Primer | GACAAGTACCAACAGGCCGA Tm= 60 GC%= 55 |
| Product Size | 186 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
