|
| Sequence Id | v.faba_CSFL_reftransV2_0032543 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101500139 UniProtKB Protein Id: A0A1S2YLD1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GGCCACCCTGAGAATTTCGA Tm= 60 GC%= 55 |
| Reverse Primer | TAGATTTCGGGTCGCATCGG Tm= 60 GC%= 55 |
| Product Size | 781 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0028016 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g116120 UniProtKB Protein Id: G7IF28 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GGTCCTCTGGGTCAGGGTAT Tm= 60 GC%= 60 |
| Reverse Primer | ACACCAAACCGAACATTGCG Tm= 60 GC%= 50 |
| Product Size | 884 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0032543 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101500139 UniProtKB Protein Id: A0A1S2YLD1 |
| Marker Type | Marker Type: EST-SSR |
| Repeat Type and Sequence | Mono (C)10 |
| Forward Primer | CTCTCCTCTCTCCCTTCCCC Tm= 60 GC%= 65 |
| Reverse Primer | TCGAAATTCTCAGGGTGGCC Tm= 60 GC%= 55 |
| Product Size | 464 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
