Morad_Mokhtar

Enzyme Id: K00655         Number of primers: 1



Enzyme Id:  K00655   &  Pathway Id:  ko00564

Sequence Id v.faba_CSFL_reftransV2_0030881
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101499039        UniProtKB Protein Id: A0A1S3EJ64
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CAACACTTGGACCGCCTTTG      Tm= 60      GC%= 55
Reverse Primer AAAGTCTGGGCTACGCTCAC      Tm= 60      GC%= 55
Product Size 907
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download