Morad_Mokhtar

Enzyme Id: K00814         Number of primers: 1



Enzyme Id:  K00814   &  Pathway Id:  ko01230

Sequence Id v.faba_CSFL_reftransV2_0020679
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101489034        UniProtKB Protein Id: A0A1S2YVG4
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer ATCCTGCTCGCTCTCAACAC      Tm= 60      GC%= 55
Reverse Primer GCGTGATACAATCGCTGCTG      Tm= 60      GC%= 55
Product Size 775
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download