Morad_Mokhtar

Enzyme Id: K00827         Number of primers: 4



Enzyme Id:  K00827   &  Pathway Id:  ko00280

Sequence Id v.faba_CSFL_reftransV2_0019520
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101494593        UniProtKB Protein Id: A0A1S2Y820
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCACCGTAACACGAACTCCA      Tm= 60      GC%= 55
Reverse Primer AGCTCATTGGCTTCTGTCCC      Tm= 60      GC%= 55
Product Size 439
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K00827   &  Pathway Id:  ko00280

Sequence Id v.faba_CSFL_reftransV2_0029174
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101493970        UniProtKB Protein Id: A0A1S2YFG5
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCGGCAGAACATACAGGGTT      Tm= 60      GC%= 55
Reverse Primer AGCGTAAAACGTTCCTCGGT      Tm= 60      GC%= 50
Product Size 892
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K00827   &  Pathway Id:  ko00280

Sequence Id v.faba_CSFL_reftransV2_0023569
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_7g072420        UniProtKB Protein Id: G7KX17
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer ATACTTTGAGCTGTGGCCCC      Tm= 60      GC%= 55
Reverse Primer CCTGATGTAGTCGCAGCGAT      Tm= 60      GC%= 55
Product Size 275
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K00827   &  Pathway Id:  ko00280

Sequence Id v.faba_CSFL_reftransV2_0007343
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101493970        UniProtKB Protein Id: A0A1S2YFG5
Marker Type Marker Type: EST-SSR
Repeat Type and Sequence Hexa      (CCTCCG)4
Forward Primer TCAACTCAACCATGGCTGCT      Tm= 60      GC%= 50
Reverse Primer ATTTCCAGGCATTTTCGCGG      Tm= 60      GC%= 50
Product Size 452
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download