|
| Sequence Id | v.faba_CSFL_reftransV2_0027319 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: PHAVU_009G129600g UniProtKB Protein Id: V7AVY2 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CAGTGGGGTGTCGCTATTCA Tm= 60 GC%= 55 |
| Reverse Primer | CCGTCAAATGAAACCCAGGC Tm= 60 GC%= 55 |
| Product Size | 189 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0004493 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101504091 UniProtKB Protein Id: A0A1S2YJC3 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AATGCATCTCCTGGTGCCAA Tm= 60 GC%= 50 |
| Reverse Primer | CTTTGGCAGCTGGAGGATCA Tm= 60 GC%= 55 |
| Product Size | 205 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0022694 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_3g088575 UniProtKB Protein Id: A0A072VB02 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CAACTAGCACCCACCCTGAG Tm= 60 GC%= 60 |
| Reverse Primer | TGCCTGGTGCCAACGATATT Tm= 60 GC%= 50 |
| Product Size | 540 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0029239 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g073350 UniProtKB Protein Id: A0A072VK73 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ATGTGGACCTGGTTGTTGCA Tm= 60 GC%= 50 |
| Reverse Primer | TGCATTGCAGCTGTTGAACC Tm= 60 GC%= 50 |
| Product Size | 445 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0032076 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g029620 UniProtKB Protein Id: A0A072VFW9 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCGACGGAACCTCATACGAG Tm= 60 GC%= 60 |
| Reverse Primer | GTCGAGGCGTATTGTCGGAT Tm= 60 GC%= 55 |
| Product Size | 115 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
