|
| Sequence Id | v.faba_CSFL_reftransV2_0033352 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g009660 UniProtKB Protein Id: A0A072TKF0 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GTTACGGAGGGAGATGCGAG Tm= 60 GC%= 60 |
| Reverse Primer | ACCCAATCCGAATTCAGCGT Tm= 60 GC%= 50 |
| Product Size | 126 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0010442 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101511593 UniProtKB Protein Id: A0A1S2YS08 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GGCGAAACAACCACCAAGTC Tm= 60 GC%= 55 |
| Reverse Primer | GCCAAAAACATCACCGCTGT Tm= 60 GC%= 50 |
| Product Size | 266 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
