|
| Sequence Id | v.faba_CSFL_reftransV2_0021609 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_7g104270 UniProtKB Protein Id: G7L609 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACTGACCCTGGGATCGATGA Tm= 60 GC%= 55 |
| Reverse Primer | GCCGTCGGATTTTACATGCC Tm= 60 GC%= 55 |
| Product Size | 678 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0013672 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g039410 UniProtKB Protein Id: B7FJZ5 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GTCCATCTGCCCCATGAACA Tm= 60 GC%= 55 |
| Reverse Primer | GCAACCAGAAATGCCTTGCA Tm= 60 GC%= 50 |
| Product Size | 133 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
