Morad_Mokhtar

Enzyme Id: K01438         Number of primers: 1



Enzyme Id:  K01438   &  Pathway Id:  ko01230

Sequence Id v.faba_CSFL_reftransV2_0002040
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101505292        UniProtKB Protein Id: A0A1S2YY53
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer ATCAATCCGCTGGAGCTAGC      Tm= 60      GC%= 55
Reverse Primer GATCACAAGCGACCCCAGAA      Tm= 60      GC%= 55
Product Size 382
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download