Morad_Mokhtar

Enzyme Id: K01495         Number of primers: 2



Enzyme Id:  K01495   &  Pathway Id:  ko00790

Sequence Id v.faba_CSFL_reftransV2_0032772
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101491091        UniProtKB Protein Id: A0A1S2YUS0
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCTGAAGCCGGCCTAGAAAA      Tm= 60      GC%= 55
Reverse Primer ACGACTCTTTGGCCAGAAGG      Tm= 60      GC%= 55
Product Size 161
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K01495   &  Pathway Id:  ko00790

Sequence Id v.faba_CSFL_reftransV2_0014992
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_7g055700        UniProtKB Protein Id: G7L058
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TCCACCAGCATGACCAACTC      Tm= 60      GC%= 55
Reverse Primer CACCACTTCGTGTTGCCAAG      Tm= 60      GC%= 55
Product Size 128
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download