Morad_Mokhtar

Enzyme Id: K01513         Number of primers: 2



Enzyme Id:  K01513   &  Pathway Id:  ko00770

Sequence Id v.faba_CSFL_reftransV2_0032973
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_8g101560        UniProtKB Protein Id: G7LJJ3
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AAACTCAACCACCCCGTTGT      Tm= 60      GC%= 50
Reverse Primer AAACCAGAAGCCGGACGAAT      Tm= 60      GC%= 50
Product Size 776
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K01513   &  Pathway Id:  ko00770

Sequence Id v.faba_CSFL_reftransV2_0013432
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101507998        UniProtKB Protein Id: A0A1S3EG26
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TACTCCATCGTCACGGGTCT      Tm= 60      GC%= 55
Reverse Primer CTTGATGATCGGGGTCCTCG      Tm= 60      GC%= 60
Product Size 352
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download