|
| Sequence Id | v.faba_CSFL_reftransV2_0034359 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_3g070290 UniProtKB Protein Id: G7JB70 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGCCTCCCAGACATCCATCT Tm= 60 GC%= 55 |
| Reverse Primer | AAGCAGCCAGAATACACCCC Tm= 60 GC%= 55 |
| Product Size | 451 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0015044 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101507925 UniProtKB Protein Id: A0A1S2Y7M8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCAAACGTCACCCAACGAAC Tm= 60 GC%= 55 |
| Reverse Primer | GTGAGCATCCCCGGAGAAAA Tm= 60 GC%= 55 |
| Product Size | 236 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0027936 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101489414 UniProtKB Protein Id: A0A1S2Y043 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGGATCCAGCCCATCCTCTT Tm= 60 GC%= 55 |
| Reverse Primer | TAAAGGCGGCTTCTCACGTT Tm= 60 GC%= 50 |
| Product Size | 665 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
