Morad_Mokhtar

Enzyme Id: K01711         Number of primers: 1



Enzyme Id:  K01711   &  Pathway Id:  ko00520

Sequence Id v.faba_CSFL_reftransV2_0014979
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101498900        UniProtKB Protein Id: A0A1S2YYX8
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer ATCCTCCGTCGCAACAACAT      Tm= 60      GC%= 50
Reverse Primer GATCTCACATCGACGCGTCT      Tm= 60      GC%= 55
Product Size 419
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download