Morad_Mokhtar

Enzyme Id: K01761         Number of primers: 2



Enzyme Id:  K01761   &  Pathway Id:  ko00450

Sequence Id v.faba_CSFL_reftransV2_0029632
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_3g080850        UniProtKB Protein Id: G7J805
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AACATCTGCCCCAAGACGAG      Tm= 60      GC%= 55
Reverse Primer TAACAACAAACGCAGCCACG      Tm= 60      GC%= 50
Product Size 691
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K01761   &  Pathway Id:  ko00450

Sequence Id v.faba_CSFL_reftransV2_0013567
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_1g077890        UniProtKB Protein Id: A0A072VNE2
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CACCGTGATGGAACCAGACA      Tm= 60      GC%= 55
Reverse Primer CTTGCACTTCCACACACAGC      Tm= 60      GC%= 55
Product Size 588
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download