|
| Sequence Id | v.faba_CSFL_reftransV2_0037098 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101492480 UniProtKB Protein Id: A0A1S2XJ45 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GCAGCTGCACAATTGTTGGA Tm= 60 GC%= 50 |
| Reverse Primer | AAAGCATGCTCATCTGGGCT Tm= 60 GC%= 50 |
| Product Size | 927 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0017939 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g013425 UniProtKB Protein Id: I3SIU5 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CACCCTATTGCGGACTCGAT Tm= 60 GC%= 55 |
| Reverse Primer | TCACAAACAGCGGAGGATCC Tm= 60 GC%= 55 |
| Product Size | 122 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0037098 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101492480 UniProtKB Protein Id: A0A1S2XJ45 |
| Marker Type | Marker Type: EST-SSR |
| Repeat Type and Sequence | Tri (CAT)5 |
| Forward Primer | AGCTGTCACCTTCACACACA Tm= 59 GC%= 50 |
| Reverse Primer | CCACACCCAACAAAACGCAT Tm= 60 GC%= 50 |
| Product Size | 483 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
