|
| Sequence Id | v.faba_CSFL_reftransV2_0012224 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101509823 UniProtKB Protein Id: A0A1S2Z5A5 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGAAGACTTGCACGCGAGAA Tm= 60 GC%= 50 |
| Reverse Primer | CGAGCTGTCCGATGTCTCTC Tm= 60 GC%= 60 |
| Product Size | 707 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0025138 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101500971 UniProtKB Protein Id: A0A1S2YA55 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCAGTGTCGTGTTTCCGGAG Tm= 60 GC%= 55 |
| Reverse Primer | GGCAATTATTTCGGCGCCAT Tm= 60 GC%= 50 |
| Product Size | 152 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
