|
| Sequence Id | v.faba_CSFL_reftransV2_0017105 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g436760 UniProtKB Protein Id: A0A072V611 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCACCATGGCATCCAAGCTA Tm= 60 GC%= 55 |
| Reverse Primer | AGGGCATCTGAACAGCAACA Tm= 60 GC%= 50 |
| Product Size | 303 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0007967 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101506446 UniProtKB Protein Id: A0A1S2YJS6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCACCAAGTACCACTTCGGC Tm= 60 GC%= 55 |
| Reverse Primer | CTGCTGGGGATGGTGATGTT Tm= 60 GC%= 55 |
| Product Size | 526 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0003304 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101515155 UniProtKB Protein Id: A0A1S2XDZ2 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGCCAAACAGTTCTTGCAGC Tm= 60 GC%= 50 |
| Reverse Primer | TAGCTTGGATGCCATGGTGG Tm= 60 GC%= 55 |
| Product Size | 339 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
