Morad_Mokhtar

Enzyme Id: K02140         Number of primers: 2



Enzyme Id:  K02140   &  Pathway Id:  ko00190

Sequence Id v.faba_CSFL_reftransV2_0015715
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101497763        UniProtKB Protein Id: A0A1S2YE81
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TTTACACTCGCCTCGCAAGT      Tm= 60      GC%= 50
Reverse Primer GCAAAGCATTCCAGGCCAAA      Tm= 60      GC%= 50
Product Size 145
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K02140   &  Pathway Id:  ko00190

Sequence Id v.faba_CSFL_reftransV2_0015746
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101497430        UniProtKB Protein Id: A0A1S2YF39
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer ACACATTGCCATGCGGAATG      Tm= 60      GC%= 50
Reverse Primer ACCCGTCTTGCTAGCATTCC      Tm= 60      GC%= 55
Product Size 273
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download