|
| Sequence Id | v.faba_CSFL_reftransV2_0018765 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101488705 UniProtKB Protein Id: A0A1S2YYF7 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CTCTCACACGCCAGTTGACT Tm= 60 GC%= 55 |
| Reverse Primer | AGCCCTCCAGCATAGGAAGA Tm= 60 GC%= 55 |
| Product Size | 298 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0027648 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101496412 UniProtKB Protein Id: A0A1S2Z4N1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TTGGAAGCAAACTGAAGCGC Tm= 60 GC%= 50 |
| Reverse Primer | CCTCTCCGACGTTGGTTTCA Tm= 60 GC%= 55 |
| Product Size | 312 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
