Morad_Mokhtar

Enzyme Id: K02732         Number of primers: 1



Enzyme Id:  K02732   &  Pathway Id:  ko03050

Sequence Id v.faba_CSFL_reftransV2_0003226
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101504878        UniProtKB Protein Id: A0A1S3EGP6
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CAACAGCGACACAGGATCCT      Tm= 60      GC%= 55
Reverse Primer CACCGCATCAGACCTACTCC      Tm= 60      GC%= 60
Product Size 101
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download