|
| Sequence Id | v.faba_CSFL_reftransV2_0009890 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_4g032660 UniProtKB Protein Id: G7JN88 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACGCAACACCAAACAAACCC Tm= 60 GC%= 50 |
| Reverse Primer | GCACCGAGGAACAAGCAAAG Tm= 60 GC%= 55 |
| Product Size | 443 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0011997 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: TanjilG_16661 UniProtKB Protein Id: A0A1J7GD56 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGAAGCGAGGAAATGGCAT Tm= 60 GC%= 50 |
| Reverse Primer | CCGATCCAACAAGCACCTCT Tm= 60 GC%= 55 |
| Product Size | 348 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
