|
| Sequence Id | v.faba_CSFL_reftransV2_0018172 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g087910 UniProtKB Protein Id: A0A072VMH3 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACGCCTAGCATGCTTCCTTT Tm= 60 GC%= 50 |
| Reverse Primer | AAGAGAGGCGAGGCTTCCTA Tm= 60 GC%= 55 |
| Product Size | 280 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0022392 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_7g108955 UniProtKB Protein Id: I3SA92 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AAACTCGTGGGAAATCGCCT Tm= 60 GC%= 50 |
| Reverse Primer | CTTCCGCACTTGAGGACACT Tm= 60 GC%= 55 |
| Product Size | 328 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0018172 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_1g087910 UniProtKB Protein Id: A0A072VMH3 |
| Marker Type | Marker Type: EST-SSR |
| Repeat Type and Sequence | Mono (A)10 |
| Forward Primer | ATCTCCACGATGCAGGGAAT Tm= 59 GC%= 50 |
| Reverse Primer | GTGCCGATGTGAGGATCTCC Tm= 60 GC%= 60 |
| Product Size | 305 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
