Morad_Mokhtar

Enzyme Id: K02947         Number of primers: 1



Enzyme Id:  K02947   &  Pathway Id:  ko03010

Sequence Id v.faba_CSFL_reftransV2_0015009
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101499786        UniProtKB Protein Id: A0A1S2Z924
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AGCACCCAGAAATCGACGTT      Tm= 60      GC%= 50
Reverse Primer AGATCCACGACCAAAGCCAG      Tm= 60      GC%= 55
Product Size 413
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download