|
| Sequence Id | v.faba_CSFL_reftransV2_0033666 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101494373 UniProtKB Protein Id: A0A1S2Z7S6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CTATCGGTCCACTTGGTCGG Tm= 60 GC%= 60 |
| Reverse Primer | AGAAATGAGGTGGGCGACTG Tm= 60 GC%= 55 |
| Product Size | 582 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0021674 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101510003 UniProtKB Protein Id: A0A1S2YWL1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGCAAGATGGAGCTTCCTG Tm= 60 GC%= 55 |
| Reverse Primer | CTTGCAAAAATGGGGAGGGC Tm= 60 GC%= 55 |
| Product Size | 208 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
