Morad_Mokhtar

Enzyme Id: K02997         Number of primers: 2



Enzyme Id:  K02997   &  Pathway Id:  ko03010

Sequence Id v.faba_CSFL_reftransV2_0017616
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101493843        UniProtKB Protein Id: A0A1S2Y673
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CTCCTCATCTCCATCACCGC      Tm= 60      GC%= 60
Reverse Primer TAGGCAAAGGCACATCAGGG      Tm= 60      GC%= 55
Product Size 190
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K02997   &  Pathway Id:  ko03010

Sequence Id v.faba_CSFL_reftransV2_0027670
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101514072        UniProtKB Protein Id: A0A1S2YRH3
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AGTTGAAGCTCGTCGGTGAG      Tm= 60      GC%= 55
Reverse Primer CTTCACCCTTCCTGGACGTC      Tm= 60      GC%= 60
Product Size 440
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download