|
| Sequence Id | v.faba_CSFL_reftransV2_0026378 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101511195 UniProtKB Protein Id: A0A1S3EFU4 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACATCTCATGGCATGGCACA Tm= 60 GC%= 50 |
| Reverse Primer | CGAATGATGAGGAGAGGGCC Tm= 60 GC%= 60 |
| Product Size | 989 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0011673 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g106700 UniProtKB Protein Id: A0A072TX42 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGCTACCAACCTGAACACGG Tm= 60 GC%= 55 |
| Reverse Primer | CTGTTCTGCACGTCCACTCT Tm= 60 GC%= 55 |
| Product Size | 150 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
