Morad_Mokhtar

Enzyme Id: K04121         Number of primers: 1



Enzyme Id:  K04121   &  Pathway Id:  ko00904

Sequence Id v.faba_CSFL_reftransV2_0024931
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_2g064295        UniProtKB Protein Id: A0A072VJA0
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCATTGAGACGCAGCATTCG      Tm= 60      GC%= 55
Reverse Primer AGCAATGGGGTATTGGCGAA      Tm= 60      GC%= 50
Product Size 637
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download