|
Sequence Id | v.faba_CSFL_reftransV2_0031035 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g025540 UniProtKB Protein Id: Q2HVG4 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | TACATCTACACCGCGGATGC Tm= 60 GC%= 55 |
Reverse Primer | GAGAACCAACGGCGAAACAC Tm= 60 GC%= 55 |
Product Size | 353 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |
|
Sequence Id | v.faba_CSFL_reftransV2_0022762 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101512342 UniProtKB Protein Id: A0A1S2YNT7 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | GAGACCACTCACGCTGTTGA Tm= 60 GC%= 55 |
Reverse Primer | TGGTGCTGGTTTTGCAATCG Tm= 60 GC%= 50 |
Product Size | 335 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |