|
| Sequence Id | v.faba_CSFL_reftransV2_0035017 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g088130 UniProtKB Protein Id: A2Q4I2 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CTTTGTGAGCCAGCCACAAC Tm= 60 GC%= 55 |
| Reverse Primer | CCCGAAAACACTGCAACAGG Tm= 60 GC%= 55 |
| Product Size | 467 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0007105 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_4g061070 UniProtKB Protein Id: G7JRH8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGAGTCCCCGTACCTACCAC Tm= 60 GC%= 60 |
| Reverse Primer | AGGAAGAGAGGGCGGATCTT Tm= 60 GC%= 55 |
| Product Size | 273 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0009587 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_4g055310 UniProtKB Protein Id: G7JKZ4 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCTCCACATCGTCGGAGAAG Tm= 60 GC%= 60 |
| Reverse Primer | TCGCGGAATAATGGGCTCTC Tm= 60 GC%= 55 |
| Product Size | 346 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0020566 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101515369 UniProtKB Protein Id: A0A1S2XG69 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TACTCGGGTCGTCCTGGATT Tm= 60 GC%= 55 |
| Reverse Primer | AAACCCAACGTGACCAACCT Tm= 60 GC%= 50 |
| Product Size | 634 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
