|
| Sequence Id | v.faba_CSFL_reftransV2_0013282 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g465300 UniProtKB Protein Id: A0A072U9U8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AAAAACCAACGCACTCGCTC Tm= 60 GC%= 50 |
| Reverse Primer | CAGCGATATTCGGGTCGGAA Tm= 60 GC%= 55 |
| Product Size | 153 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0026155 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_7g033710 UniProtKB Protein Id: A0A072TY73 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACCTTGGTAAAGCGTCTCCG Tm= 60 GC%= 55 |
| Reverse Primer | CTGCTTGTCAAGGTGCCAAC Tm= 60 GC%= 55 |
| Product Size | 120 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
