|
| Sequence Id | v.faba_CSFL_reftransV2_0028654 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g011870 UniProtKB Protein Id: A0A072UGT3 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CTGCAAGGCCTAATGGGTCA Tm= 60 GC%= 55 |
| Reverse Primer | TCCGGTGAAGCTCCATCCTA Tm= 60 GC%= 55 |
| Product Size | 418 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0032395 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LR48_Vigan10g140500 UniProtKB Protein Id: A0A0L9VKL9 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCCGGTGAAGCTCCATCCTA Tm= 60 GC%= 55 |
| Reverse Primer | CCACCTGGGTACAATGGGTC Tm= 60 GC%= 60 |
| Product Size | 392 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
