Morad_Mokhtar

Enzyme Id: K08967         Number of primers: 2



Enzyme Id:  K08967   &  Pathway Id:  ko00270

Sequence Id v.faba_CSFL_reftransV2_0022816
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101502127        UniProtKB Protein Id: A0A1S2XYZ5
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CGAATCCAAGCCTCATTGCG      Tm= 60      GC%= 55
Reverse Primer CCGAAGCTCAAACAAACGCA      Tm= 60      GC%= 50
Product Size 401
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K08967   &  Pathway Id:  ko00270

Sequence Id v.faba_CSFL_reftransV2_0014312
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101503188        UniProtKB Protein Id: A0A1S2Y0S3
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CAGGCATGGTTGATGGACGA      Tm= 60      GC%= 55
Reverse Primer GATCACCGGCCTTGATCCAA      Tm= 60      GC%= 55
Product Size 364
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download