Morad_Mokhtar

Enzyme Id: K09841         Number of primers: 1



Enzyme Id:  K09841   &  Pathway Id:  ko00906

Sequence Id v.faba_CSFL_reftransV2_0007914
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_4g052350        UniProtKB Protein Id: I3SBG4
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GAAACTGCCGTGAACACCAC      Tm= 60      GC%= 55
Reverse Primer CCGATAGCCGCAGAAGTAGG      Tm= 60      GC%= 60
Product Size 232
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download