|
| Sequence Id | v.faba_CSFL_reftransV2_0004715 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g043740 UniProtKB Protein Id: G7KJ00 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GCACAGTGCCACCAAAACAA Tm= 60 GC%= 50 |
| Reverse Primer | GAAACACCCAAAACGAGGCC Tm= 60 GC%= 55 |
| Product Size | 290 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0020134 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_5g087590 UniProtKB Protein Id: B7FIH8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGCATTGAGCTCGGTGATT Tm= 60 GC%= 50 |
| Reverse Primer | GCACAGTTGCGGAACACATT Tm= 60 GC%= 50 |
| Product Size | 788 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0020534 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g037340 UniProtKB Protein Id: A0A072UJC1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ATGTTCCCGCCACCATCTTC Tm= 60 GC%= 55 |
| Reverse Primer | AAAGATCCAAAACGACGCCG Tm= 59 GC%= 50 |
| Product Size | 228 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
