|
Sequence Id | v.faba_CSFL_reftransV2_0004715 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g043740 UniProtKB Protein Id: G7KJ00 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | GCACAGTGCCACCAAAACAA Tm= 60 GC%= 50 |
Reverse Primer | GAAACACCCAAAACGAGGCC Tm= 60 GC%= 55 |
Product Size | 290 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |
|
Sequence Id | v.faba_CSFL_reftransV2_0020134 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_5g087590 UniProtKB Protein Id: B7FIH8 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | TGGCATTGAGCTCGGTGATT Tm= 60 GC%= 50 |
Reverse Primer | GCACAGTTGCGGAACACATT Tm= 60 GC%= 50 |
Product Size | 788 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |
|
Sequence Id | v.faba_CSFL_reftransV2_0020534 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_6g037340 UniProtKB Protein Id: A0A072UJC1 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | ATGTTCCCGCCACCATCTTC Tm= 60 GC%= 55 |
Reverse Primer | AAAGATCCAAAACGACGCCG Tm= 59 GC%= 50 |
Product Size | 228 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |