|
| Sequence Id | v.faba_CSFL_reftransV2_0015873 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_3g112130 UniProtKB Protein Id: A0A072V3D0 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGGAGTCCTTGATCGGCTCT Tm= 60 GC%= 55 |
| Reverse Primer | ATTCCATGCGGACCCCAAAT Tm= 60 GC%= 50 |
| Product Size | 277 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0003777 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101494480 UniProtKB Protein Id: A0A1S2Y4G8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGGAAACATCAACTCGCGA Tm= 60 GC%= 50 |
| Reverse Primer | CCTCCCCCACCATACCACTA Tm= 60 GC%= 60 |
| Product Size | 420 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
