|
| Sequence Id | v.faba_CSFL_reftransV2_0023023 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC100306707 UniProtKB Protein Id: I1LV57 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCAACTCACTCGGTGCAGAT Tm= 60 GC%= 55 |
| Reverse Primer | TGTGACGACGGGTACATGTG Tm= 60 GC%= 55 |
| Product Size | 112 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0005958 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g078010 UniProtKB Protein Id: A0A072VAH5 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCAGTGTTGTCGATGGTGGA Tm= 60 GC%= 55 |
| Reverse Primer | TATCAAATTGCGGCGCCATG Tm= 60 GC%= 50 |
| Product Size | 189 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
