|
| Sequence Id | v.faba_CSFL_reftransV2_0030966 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101498370 UniProtKB Protein Id: A0A1S2XSF1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ATGAGGTTGGGGCTGCTAAC Tm= 60 GC%= 55 |
| Reverse Primer | GGCTGTTGAAGTGGCAGTTG Tm= 60 GC%= 55 |
| Product Size | 925 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0034902 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g018880 UniProtKB Protein Id: A0A072V4U2 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGACACATATGACGTGGCA Tm= 59 GC%= 50 |
| Reverse Primer | AGGCTATCGGCAAGACCTTG Tm= 60 GC%= 55 |
| Product Size | 100 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
