Morad_Mokhtar

Enzyme Id: K10756         Number of primers: 3



Enzyme Id:  K10756   &  Pathway Id:  ko03430

Sequence Id v.faba_CSFL_reftransV2_0023656
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101510394        UniProtKB Protein Id: A0A1S2YCV4
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GAGCAGACAAGCCACTGTCT      Tm= 60      GC%= 55
Reverse Primer CAGCATTGCAGTCGAGATGC      Tm= 60      GC%= 55
Product Size 126
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K10756   &  Pathway Id:  ko03430

Sequence Id v.faba_CSFL_reftransV2_0031830
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101505338        UniProtKB Protein Id: A0A1S3E4R2
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TTCATCCGTTCACCGTTCGT      Tm= 60      GC%= 50
Reverse Primer AGCCTGCATCACTTGGAGTC      Tm= 60      GC%= 55
Product Size 360
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K10756   &  Pathway Id:  ko03430

Sequence Id v.faba_CSFL_reftransV2_0024524
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101491458        UniProtKB Protein Id: A0A1S2Y7Q5
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GGACTCTGCTCGCTGACTAC      Tm= 60      GC%= 60
Reverse Primer TCCGTCAAGCCATTCGTTCA      Tm= 60      GC%= 50
Product Size 133
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download