Enzyme Id: K10885 & Pathway Id: ko03450 |
|
| Sequence Id | v.faba_CSFL_reftransV2_0030439 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101502782 UniProtKB Protein Id: A0A1S2YLI0 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AAGCGCGACTAAACACTCGA Tm= 60 GC%= 50 |
| Reverse Primer | TGGAAATGCAAAAGCTGGCC Tm= 60 GC%= 50 |
| Product Size | 811 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | |
Enzyme Id: K10885 & Pathway Id: ko03450 |
|
| Sequence Id | v.faba_CSFL_reftransV2_0026615 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_4g023560 UniProtKB Protein Id: G7JDE1 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGAAATGCAAAAGCTGGCC Tm= 60 GC%= 50 |
| Reverse Primer | AAGCGCGACTAAACACTCGA Tm= 60 GC%= 50 |
| Product Size | 811 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | |