|
| Sequence Id | v.faba_CSFL_reftransV2_0018537 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g098715 UniProtKB Protein Id: A0A072TV88 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GGATTGATGATTCCACGCGC Tm= 60 GC%= 55 |
| Reverse Primer | CCTAATGGTGGTGGCGAAGT Tm= 60 GC%= 55 |
| Product Size | 173 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0003134 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101494166 UniProtKB Protein Id: A0A1S2Y344 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGCCGTGTCGTAATCAACCA Tm= 60 GC%= 50 |
| Reverse Primer | ACTTCGCCACCACCATTAGG Tm= 60 GC%= 55 |
| Product Size | 325 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
