|
| Sequence Id | v.faba_CSFL_reftransV2_0011959 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_4g025950 UniProtKB Protein Id: A0A072UI51 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ATTTAGCCCCAACCGTGTGT Tm= 60 GC%= 50 |
| Reverse Primer | TAACAGCCGAAGAAGCAGCA Tm= 60 GC%= 50 |
| Product Size | 101 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0024024 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101497021 UniProtKB Protein Id: A0A1S2XKE6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TAGTGTACGTGAGCGCTTGG Tm= 60 GC%= 55 |
| Reverse Primer | AAGCTCCACAGTAGCAACCC Tm= 60 GC%= 55 |
| Product Size | 188 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
