Morad_Mokhtar

Enzyme Id: K12160         Number of primers: 2



Enzyme Id:  K12160   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0033746
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101514162        UniProtKB Protein Id: A0A1S2YG79
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TGGCTAGCAAAGGAAAGAGCT      Tm= 60      GC%= 48
Reverse Primer TACAGAGTTGGACCCCCACC      Tm= 61      GC%= 60
Product Size 304
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K12160   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0026953
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101497378        UniProtKB Protein Id: A0A1S2Z2J4
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCCGTCCTCCATTTCAAGCT      Tm= 60      GC%= 55
Reverse Primer GAACGACCCAAAGCGAGAGA      Tm= 60      GC%= 55
Product Size 371
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download