|
Sequence Id | v.faba_CSFL_reftransV2_0033746 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101514162 UniProtKB Protein Id: A0A1S2YG79 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | TGGCTAGCAAAGGAAAGAGCT Tm= 60 GC%= 48 |
Reverse Primer | TACAGAGTTGGACCCCCACC Tm= 61 GC%= 60 |
Product Size | 304 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |
|
Sequence Id | v.faba_CSFL_reftransV2_0026953 |
NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101497378 UniProtKB Protein Id: A0A1S2Z2J4 |
Marker Type | Marker Type: EST |
Repeat Type and Sequence | - - |
Forward Primer | CCCGTCCTCCATTTCAAGCT Tm= 60 GC%= 55 |
Reverse Primer | GAACGACCCAAAGCGAGAGA Tm= 60 GC%= 55 |
Product Size | 371 |
JBrowse View | JBrowse |
Pathway Browse View | Pathway Browse |
Corresponding Sequence | Download |