Morad_Mokhtar

Enzyme Id: K12873         Number of primers: 3



Enzyme Id:  K12873   &  Pathway Id:  ko03040

Sequence Id v.faba_CSFL_reftransV2_0002700
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_8g083120        UniProtKB Protein Id: G7LH30
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GCTGCATGCACCTCAAACAA      Tm= 60      GC%= 50
Reverse Primer AATCTAATCTGCCTCCGCCG      Tm= 60      GC%= 55
Product Size 414
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K12873   &  Pathway Id:  ko03040

Sequence Id v.faba_CSFL_reftransV2_0026447
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC100814888        UniProtKB Protein Id: I1K3S1
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TCGCCTAGTAGACCGACCAA      Tm= 60      GC%= 55
Reverse Primer TCTGCAAGACACCCACATCC      Tm= 60      GC%= 55
Product Size 267
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K12873   &  Pathway Id:  ko03040

Sequence Id v.faba_CSFL_reftransV2_0026447
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC100814888        UniProtKB Protein Id: I1K3S1
Marker Type Marker Type: EST-SSR
Repeat Type and Sequence Mono      (A)10
Forward Primer TCTTGATATTGGGCTTCGGC      Tm= 58      GC%= 50
Reverse Primer TCTGCAAGACACCCACATCC      Tm= 60      GC%= 55
Product Size 348
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download