|
| Sequence Id | v.faba_CSFL_reftransV2_0035579 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101501234 UniProtKB Protein Id: A0A1S2YV02 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AAAAACGCATTGGCATCGCT Tm= 60 GC%= 45 |
| Reverse Primer | TCACCTCCTTCCCACAATGC Tm= 60 GC%= 55 |
| Product Size | 198 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0015607 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g101690 UniProtKB Protein Id: G7LJK6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACAATCATGCAGCACCTCCA Tm= 60 GC%= 50 |
| Reverse Primer | GTAACTCGTGCGGCTACGTA Tm= 60 GC%= 55 |
| Product Size | 611 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0009222 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g100340 UniProtKB Protein Id: B7FI56 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GGTGGACAAAGGTTGCATCC Tm= 59 GC%= 55 |
| Reverse Primer | ATCCTCGCATTGTACCTGCC Tm= 60 GC%= 55 |
| Product Size | 232 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0007961 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g015960 UniProtKB Protein Id: A0A072TLD9 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCACCAGCACCATCACCAAG Tm= 60 GC%= 55 |
| Reverse Primer | ATCCCTGCCCTCCAAACATG Tm= 60 GC%= 55 |
| Product Size | 109 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
